Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_103334/hsa_circ_0064996 | |||
Gene | SNRK | Organism | Human |
Genome Locus | chr3:43341245-43373802:+ | Build | hg19 |
Disease | Rheumatoid Arthritis | ICD-10 | Malignant neoplasm of skin, unspecified (C44.9) |
DBLink | Link to database | PMID | 28983619 |
Experimental Method | |||
Sample Type | Tissues | Comparison | Totally twenty RA patients and healthy people age and gender matched were selected at Xiangmihu People's Hospital, the Fourth People's Hospital of Shenzhen. After selected, blood specimens were collected in March-May in 2014 |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward ATTTGGAGTCTGGGAGTGAT ReverseACAGTGTTTTGTTAGTTGCTTCT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Zheng, F, Yu, X, Huang, J, Dai, Y (2017). Circular RNA expression profiles of peripheral blood mononuclear cells in rheumatoid arthritis patients, based on microarray chip technology. Mol Med Rep, 16, 6:8029-8036. |